Detail of EST/Unigene CO516233 |
Acc. | CO516233 |
Internal Acc. | s13dSG69A0700051_445794 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF3 OS=Nicotiana tabacum E-value=5e-44; Mitogen-activated protein kinase homolog 1 OS=Petunia hybrida E-value=4e-43; Mitogen-activated protein kinase 2 OS=Arabidopsis thaliana E-value=7e-43; Mitogen-activated protein kinase 1 OS=Arabidopsis thaliana E-value=7e-41; Mitogen-activated protein kinase 7 OS=Arabidopsis thaliana E-value=2e-40; |
Length | 555 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GAATAAATGAAACTGAAAGAAGAGAGAGAGAGAGAGAAAGAAAGAGAAATTGAAAAAATC |
EST members of Unigene | CO516233 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase |
EC | 2.7.11.24 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2850.1.S1_at
|
Corresponding NCBI Gene | 842248 |
Trichome-related Gene from Literature | N/A |