Detail of EST/Unigene CO516275 |
Acc. | CO516275 |
Internal Acc. | s13dSG69E0200007_445878 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L20, chloroplastic OS=Lotus japonicus E-value=7e-34; 50S ribosomal protein L20, chloroplastic OS=Glycine max E-value=5e-32; 50S ribosomal protein L20, chloroplastic OS=Phaseolus vulgaris E-value=8e-30; 50S ribosomal protein L20, chloroplastic OS=Morus indica E-value=1e-28; 50S ribosomal protein L20, chloroplastic OS=Cucumis sativus E-value=1e-28; |
Length | 408 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GGAAGAATCCATTTTGTTATTAATAGACTAGGAAGGATAAAAGAATAACTGAAAGAAAAA |
EST members of Unigene | CO516275 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.36084.1.S1_s_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |