| Detail of EST/Unigene CO516275 |
| Acc. | CO516275 |
| Internal Acc. | s13dSG69E0200007_445878 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L20, chloroplastic OS=Lotus japonicus E-value=7e-34; 50S ribosomal protein L20, chloroplastic OS=Glycine max E-value=5e-32; 50S ribosomal protein L20, chloroplastic OS=Phaseolus vulgaris E-value=8e-30; 50S ribosomal protein L20, chloroplastic OS=Morus indica E-value=1e-28; 50S ribosomal protein L20, chloroplastic OS=Cucumis sativus E-value=1e-28; |
| Length | 408 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGAAGAATCCATTTTGTTATTAATAGACTAGGAAGGATAAAAGAATAACTGAAAGAAAAA |
| EST members of Unigene | CO516275 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.36084.1.S1_s_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |