Detail of EST/Unigene CO516282 |
Acc. | CO516282 |
Internal Acc. | s13dSG69E1000081_445892 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus ochrogaster E-value=2e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus mexicanus E-value=2e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Rattus norvegicus E-value=4e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Ovis aries E-value=9e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Mus musculus E-value=9e-36; |
Length | 512 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | GCACGGCACATTAACTCGCCACTATCGCTTCCATCAGCAGGGCAAGGAGACGAGCACCAA |
EST members of Unigene | CO516282 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
EC | 1.1.1.42 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2852.1.S1_at
|
Corresponding NCBI Gene | 842905 |
Trichome-related Gene from Literature | N/A |