| Detail of EST/Unigene CO516282 |
| Acc. | CO516282 |
| Internal Acc. | s13dSG69E1000081_445892 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus ochrogaster E-value=2e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Microtus mexicanus E-value=2e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Rattus norvegicus E-value=4e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Ovis aries E-value=9e-36; Isocitrate dehydrogenase [NADP] cytoplasmic OS=Mus musculus E-value=9e-36; |
| Length | 512 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GCACGGCACATTAACTCGCCACTATCGCTTCCATCAGCAGGGCAAGGAGACGAGCACCAA |
| EST members of Unigene | CO516282 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00031 isocitrate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00031 isocitrate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00031 isocitrate dehydrogenase |
| EC | 1.1.1.42 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2852.1.S1_at
|
| Corresponding NCBI Gene | 842905 |
| Trichome-related Gene from Literature | N/A |