| Detail of EST/Unigene CO516483 |
| Acc. | CO516483 |
| Internal Acc. | s13dSG28E0100003_446294 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase PAK 2 OS=Oryctolagus cuniculus E-value=5e-50; Serine/threonine-protein kinase PAK 2 OS=Homo sapiens E-value=5e-50; Serine/threonine-protein kinase PAK 2 OS=Rattus norvegicus E-value=7e-50; Serine/threonine-protein kinase PAK 2 OS=Mus musculus E-value=7e-50; Serine/threonine-protein kinase PAK 3 OS=Rattus norvegicus E-value=7e-49; |
| Length | 398 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGTACCGATTTTGGTTTTTGTGCTCAAGTCTCACCGGATGAAAAACGTCAAACCATGGT |
| EST members of Unigene | CO516483 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04409 p21-activated kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04409 p21-activated kinase 1; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04409 p21-activated kinase 1 |
| EC | 2.7.11.- |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
Msa.1494.1.S1_at
|
| Corresponding NCBI Gene | 843253 |
| Trichome-related Gene from Literature | N/A |