| Detail of EST/Unigene CO516658 |
| Acc. | CO516658 |
| Internal Acc. | s13dSG66G1100086_446644 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-33; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=1e-32; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-32; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=5e-32; Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=4e-30; |
| Length | 533 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | GGGCTCTCCAAAAACAAAACCTAGACAAACAGATTTTAATCTCTTCTCCAATAGCACTCT |
| EST members of Unigene | CO516658 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1508.1.S1_at
|
| Corresponding NCBI Gene | 828790 |
| Trichome-related Gene from Literature | N/A |