| Detail of EST/Unigene CO516734 |
| Acc. | CO516734 |
| Internal Acc. | s13dSG74G0200008_446796 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=3e-25; 30S ribosomal protein S3, chloroplastic OS=Glycine max E-value=8e-25; 30S ribosomal protein S3, chloroplastic OS=Phaseolus vulgaris E-value=8e-23; 30S ribosomal protein S3, chloroplastic OS=Phaseolus angularis E-value=8e-23; 30S ribosomal protein S3, chloroplastic OS=Gossypium hirsutum E-value=8e-23; |
| Length | 481 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | TCATAATATTTAAATTTTTTAATTTAAAGGGTTATGATAATAGAAATTATGCTTTATGGA |
| EST members of Unigene | CO516734 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1518.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |