Detail of EST/Unigene CO516734 |
Acc. | CO516734 |
Internal Acc. | s13dSG74G0200008_446796 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S3, chloroplastic OS=Lotus japonicus E-value=3e-25; 30S ribosomal protein S3, chloroplastic OS=Glycine max E-value=8e-25; 30S ribosomal protein S3, chloroplastic OS=Phaseolus vulgaris E-value=8e-23; 30S ribosomal protein S3, chloroplastic OS=Phaseolus angularis E-value=8e-23; 30S ribosomal protein S3, chloroplastic OS=Gossypium hirsutum E-value=8e-23; |
Length | 481 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI1 (1 ESTs); |
Sequence | TCATAATATTTAAATTTTTTAATTTAAAGGGTTATGATAATAGAAATTATGCTTTATGGA |
EST members of Unigene | CO516734 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1518.1.S1_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |