| Detail of EST/Unigene CO516856 |
| Acc. | CO516856 |
| Internal Acc. | s13dSG98F0100011_447040 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=2e-54; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=5e-51; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=5e-51; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=1e-50; Glycine cleavage system H protein, mitochondrial OS=Flaveria trinervia E-value=4e-49; |
| Length | 383 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | AATGCTCTCAAACTCTCTTCTTCTTCCTCAAGATTACATCTCTCCCCTCCTTTTTCCATC |
| EST members of Unigene | CO516856 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.2885.1.S1_at
|
| Corresponding NCBI Gene | 840141 |
| Trichome-related Gene from Literature | N/A |