| Detail of EST/Unigene CO517060 |
| Acc. | CO517060 |
| Internal Acc. | s13dSG31H0100012_468666 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamine synthetase nodule isozyme OS=Medicago sativa E-value=1e-40; Glutamine synthetase PR-2 OS=Phaseolus vulgaris E-value=1e-38; Glutamine synthetase root isozyme A OS=Pisum sativum E-value=3e-38; Glutamine synthetase nodule isozyme OS=Vigna aconitifolia E-value=3e-38; Glutamine synthetase root isozyme B OS=Pisum sativum E-value=1e-37; |
| Length | 348 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI1 (1 ESTs); |
| Sequence | CCTTAACAAAAAAGCTAGAGATTTCTCTGTAGCTGTTTGTCTATTACTTGCTTTTCACAC |
| EST members of Unigene | CO517060 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01915 glutamine synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01915 glutamine synthetase; Metabolism > Glycan Biosynthesis and Metabolism > ko00550 Peptidoglycan biosynthesis > K01915 glutamine synthetase; Environmental Information Processing > Signal Transduction > ko02020 Two-component system > K01915 glutamine synthetase |
| EC | 6.3.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.1798.1.S1_s_at
|
| Corresponding NCBI Gene | 842935 |
| Trichome-related Gene from Literature | N/A |