| Detail of EST/Unigene CO653782 |
| Acc. | CO653782 |
| Internal Acc. | CB7-C02 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=2e-09; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=7e-09; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=2e-08; Lichenase OS=Nicotiana plumbaginifolia E-value=4e-08; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=1e-07; |
| Length | 289 nt |
| Species | Humulus lupulus |
| Belonged EST Libraries | HL_HIF_HSS (1 ESTs); |
| Sequence | AACCAAAATTGAATTAGCAGAATACCATCTTTATTATTAATTTATAGAGAGACAGAGCTC |
| EST members of Unigene | CO653782 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |