Detail of EST/Unigene CO653782 |
Acc. | CO653782 |
Internal Acc. | CB7-C02 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=2e-09; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=7e-09; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=2e-08; Lichenase OS=Nicotiana plumbaginifolia E-value=4e-08; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=1e-07; |
Length | 289 nt |
Species | Humulus lupulus |
Belonged EST Libraries | HL_HIF_HSS (1 ESTs); |
Sequence | AACCAAAATTGAATTAGCAGAATACCATCTTTATTATTAATTTATAGAGAGACAGAGCTC |
EST members of Unigene | CO653782 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |