Detail of EST/Unigene CX516596 |
Acc. | CX516596 |
Internal Acc. | s13dNF01C02VI018_359281 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-68; NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-61; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-51; NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-20; Nitrogen fixation protein NifU (Fragment) OS=Anabaena sp. (strain L31) E-value=4e-16; |
Length | 582 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (1 ESTs); |
Sequence | ATCATCTAATAAAGTAGCTTGGAAGGGAGGTGAGACAATAGTTGAATGTAGCATTCACAT |
EST members of Unigene | CX516596 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6693.1.S1_s_at
|
Corresponding NCBI Gene | 828697 |
Trichome-related Gene from Literature | N/A |