| Detail of EST/Unigene CX516596 |
| Acc. | CX516596 |
| Internal Acc. | s13dNF01C02VI018_359281 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-68; NifU-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-61; NifU-like protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-51; NifU-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-20; Nitrogen fixation protein NifU (Fragment) OS=Anabaena sp. (strain L31) E-value=4e-16; |
| Length | 582 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (1 ESTs); |
| Sequence | ATCATCTAATAAAGTAGCTTGGAAGGGAGGTGAGACAATAGTTGAATGTAGCATTCACAT |
| EST members of Unigene | CX516596 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6693.1.S1_s_at
|
| Corresponding NCBI Gene | 828697 |
| Trichome-related Gene from Literature | N/A |