| Detail of EST/Unigene CX517280 |
| Acc. | CX517280 |
| Internal Acc. | s13dNF07A07VI053_399579 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-26; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-26; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=7e-26; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=2e-25; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=2e-25; |
| Length | 539 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (1 ESTs); |
| Sequence | GTTATTCCAAGCTCCAGGGGGATACTCTAGATTACCTTGGCATCCCAGGCCTTCACTTAG |
| EST members of Unigene | CX517280 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6699.1.S1_at
|
| Corresponding NCBI Gene | 843990 |
| Trichome-related Gene from Literature | N/A |