Detail of EST/Unigene CX517280 |
Acc. | CX517280 |
Internal Acc. | s13dNF07A07VI053_399579 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-26; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-26; Chlorophyll a-b binding protein 22L, chloroplastic OS=Petunia sp. E-value=7e-26; Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=2e-25; Chlorophyll a-b binding protein 22R, chloroplastic OS=Petunia sp. E-value=2e-25; |
Length | 539 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (1 ESTs); |
Sequence | GTTATTCCAAGCTCCAGGGGGATACTCTAGATTACCTTGGCATCCCAGGCCTTCACTTAG |
EST members of Unigene | CX517280 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6699.1.S1_at
|
Corresponding NCBI Gene | 843990 |
Trichome-related Gene from Literature | N/A |