Detail of EST/Unigene CX520862 |
Acc. | CX520862 |
Internal Acc. | s13dNF56H11VI094_449510 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit II, chloroplastic OS=Cucumis sativus E-value=1e-77; Photosystem I reaction center subunit II, chloroplastic OS=Solanum lycopersicum E-value=4e-72; Photosystem I reaction center subunit II, chloroplastic OS=Nicotiana sylvestris E-value=5e-72; Photosystem I reaction center subunit II, chloroplastic OS=Spinacia oleracea E-value=4e-68; Photosystem I reaction center subunit II-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-66; |
Length | 616 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (1 ESTs); |
Sequence | GGCAACTCAAACCACCCTCTTCACCCCACCTTTCTTTAGTGCCAAACCCAATGAACATGT |
EST members of Unigene | CX520862 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34726.1.S1_at
|
Corresponding NCBI Gene | 828183 |
Trichome-related Gene from Literature | N/A |