| Detail of EST/Unigene CX520862 |
| Acc. | CX520862 |
| Internal Acc. | s13dNF56H11VI094_449510 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit II, chloroplastic OS=Cucumis sativus E-value=1e-77; Photosystem I reaction center subunit II, chloroplastic OS=Solanum lycopersicum E-value=4e-72; Photosystem I reaction center subunit II, chloroplastic OS=Nicotiana sylvestris E-value=5e-72; Photosystem I reaction center subunit II, chloroplastic OS=Spinacia oleracea E-value=4e-68; Photosystem I reaction center subunit II-1, chloroplastic OS=Arabidopsis thaliana E-value=5e-66; |
| Length | 616 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (1 ESTs); |
| Sequence | GGCAACTCAAACCACCCTCTTCACCCCACCTTTCTTTAGTGCCAAACCCAATGAACATGT |
| EST members of Unigene | CX520862 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34726.1.S1_at
|
| Corresponding NCBI Gene | 828183 |
| Trichome-related Gene from Literature | N/A |