Detail of EST/Unigene CX522060 |
Acc. | CX522060 |
Internal Acc. | s13dNF68F07VI061_469924 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Putative PAP-specific phosphatase, mitochondrial OS=Arabidopsis thaliana E-value=2e-45; PAP-specific phosphatase HAL2-like OS=Arabidopsis thaliana E-value=3e-07; 3'(2'),5'-bisphosphate nucleotidase 2 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) E-value=3e-06; 3'(2'),5'-bisphosphate nucleotidase 1 OS=Candida albicans (strain WO-1) E-value=3e-06; 3'(2'),5'-bisphosphate nucleotidase 1 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) E-value=3e-06; |
Length | 577 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (1 ESTs); |
Sequence | AGTCAATCATGGGAATCACTTCCATTATCTTCTATATTTAATGCAACAAGCAATGCAAAT |
EST members of Unigene | CX522060 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34741.1.S1_at
|
Corresponding NCBI Gene | 825853 |
Trichome-related Gene from Literature | N/A |