| Detail of EST/Unigene CX522060 |
| Acc. | CX522060 |
| Internal Acc. | s13dNF68F07VI061_469924 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative PAP-specific phosphatase, mitochondrial OS=Arabidopsis thaliana E-value=2e-45; PAP-specific phosphatase HAL2-like OS=Arabidopsis thaliana E-value=3e-07; 3'(2'),5'-bisphosphate nucleotidase 2 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) E-value=3e-06; 3'(2'),5'-bisphosphate nucleotidase 1 OS=Candida albicans (strain WO-1) E-value=3e-06; 3'(2'),5'-bisphosphate nucleotidase 1 OS=Candida albicans (strain SC5314 / ATCC MYA-2876) E-value=3e-06; |
| Length | 577 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (1 ESTs); |
| Sequence | AGTCAATCATGGGAATCACTTCCATTATCTTCTATATTTAATGCAACAAGCAATGCAAAT |
| EST members of Unigene | CX522060 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34741.1.S1_at
|
| Corresponding NCBI Gene | 825853 |
| Trichome-related Gene from Literature | N/A |