| Detail of EST/Unigene CX523411 |
| Acc. | CX523411 |
| Internal Acc. | s13dNF1HC06VI050_474542 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Xanthine dehydrogenase 1 OS=Arabidopsis thaliana E-value=2e-85; Xanthine dehydrogenase 2 OS=Arabidopsis thaliana E-value=2e-83; Xanthine dehydrogenase OS=Oryza sativa subsp. japonica E-value=4e-81; Xanthine dehydrogenase OS=Dictyostelium discoideum E-value=4e-52; Xanthine dehydrogenase/oxidase OS=Homo sapiens E-value=1e-45; |
| Length | 540 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_VILEAF (1 ESTs); |
| Sequence | GCAGTTTTAGATGCTTGTGAGCAAATAAAGGCACGCATGGAACCTATTGCTTCTCGACAT |
| EST members of Unigene | CX523411 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00087 xanthine dehydrogenase; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K00106 xanthine oxidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00106 xanthine oxidase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00106 xanthine oxidase |
| EC | 1.17.1.4 1.17.3.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6755.1.S1_at
|
| Corresponding NCBI Gene | 829641 |
| Trichome-related Gene from Literature | N/A |