Detail of EST/Unigene CX523432 |
Acc. | CX523432 |
Internal Acc. | s13dNF1HE04VI035_474584 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Medicago sativa E-value=1e-80; Ribulose bisphosphate carboxylase small chain 3A, chloroplastic OS=Pisum sativum E-value=2e-78; Ribulose bisphosphate carboxylase small chain 3C, chloroplastic OS=Pisum sativum E-value=2e-77; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Trifolium repens E-value=5e-74; Ribulose bisphosphate carboxylase small chain, chloroplastic OS=Glycine tomentella E-value=7e-72; |
Length | 548 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (1 ESTs); |
Sequence | GGCAGAGGGTGAACTAAGGGAGAAAAACATGGCTTCCTCTATGATGTCCTCTTCAGCTGT |
EST members of Unigene | CX523432 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843029 |
Trichome-related Gene from Literature | 843029 |