Detail of EST/Unigene CX523538 |
Acc. | CX523538 |
Internal Acc. | s13dNF84F08VI075_474796 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | APO protein 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-33; APO protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-25; APO protein 3, mitochondrial OS=Arabidopsis thaliana E-value=2e-25; APO protein 4, mitochondrial OS=Arabidopsis thaliana E-value=5e-07; |
Length | 375 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (1 ESTs); |
Sequence | GATCATTTAAACATCAATGGAGAGATGGAAAACATGGTTGGCAAGATGCTACTTTAGATG |
EST members of Unigene | CX523538 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34756.1.S1_at
|
Corresponding NCBI Gene | 842789 |
Trichome-related Gene from Literature | N/A |