Detail of EST/Unigene CX523743 |
Acc. | CX523743 |
Internal Acc. | s13dNF01E04AT035_336333 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 370 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (1 ESTs); |
Sequence | TGAACTTGATGATCATCGATCTAAGGTTGATGCATCAGATGTTGCAATATGTAGGGTGGA |
EST members of Unigene | CX523743 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00164 2-oxoglutarate dehydrogenase E1 component; Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K00164 2-oxoglutarate dehydrogenase E1 component; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00164 2-oxoglutarate dehydrogenase E1 component |
EC | 1.2.4.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6760.1.S1_at
|
Corresponding NCBI Gene | 824707 |
Trichome-related Gene from Literature | N/A |