| Detail of EST/Unigene CX523743 |
| Acc. | CX523743 |
| Internal Acc. | s13dNF01E04AT035_336333 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 370 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (1 ESTs); |
| Sequence | TGAACTTGATGATCATCGATCTAAGGTTGATGCATCAGATGTTGCAATATGTAGGGTGGA |
| EST members of Unigene | CX523743 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00164 2-oxoglutarate dehydrogenase E1 component; Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K00164 2-oxoglutarate dehydrogenase E1 component; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00164 2-oxoglutarate dehydrogenase E1 component |
| EC | 1.2.4.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.6760.1.S1_at
|
| Corresponding NCBI Gene | 824707 |
| Trichome-related Gene from Literature | N/A |