| Detail of EST/Unigene CX524153 |
| Acc. | CX524153 |
| Internal Acc. | s13dNF06E04AT024_447650 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | DNA polymerase III subunit gamma/tau OS=Mycoplasma genitalium (strain ATCC 33530 / G-37 / NCTC 10195) E-value=2e-21; DNA polymerase III subunit gamma OS=Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp) E-value=6e-21; DNA polymerase III subunit gamma/tau OS=Bacillus subtilis (strain 168) E-value=1e-20; DNA polymerase III subunit gamma OS=Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS) E-value=2e-19; DNA polymerase III subunit gamma OS=Buchnera aphidicola subsp. Schizaphis graminum (strain Sg) E-value=3e-19; |
| Length | 495 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (1 ESTs); |
| Sequence | AATTGTAGTTCGTCGGAACACCCAAAACCCTGTGGTTTTTGCAATTATTGCATAGCACAT |
| EST members of Unigene | CX524153 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10756 replication factor C subunit 3/5 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34772.1.S1_at
|
| Corresponding NCBI Gene | 827616 |
| Trichome-related Gene from Literature | N/A |