| Detail of EST/Unigene CX524320 |
| Acc. | CX524320 |
| Internal Acc. | s13dNF14D09AT076_447984 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 2, chloroplastic OS=Pisum sativum E-value=1e-82; Oxygen-evolving enhancer protein 2, chloroplastic OS=Spinacia oleracea E-value=9e-63; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum tuberosum E-value=3e-61; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=9e-60; Oxygen-evolving enhancer protein 2, chloroplastic OS=Solanum lycopersicum E-value=2e-59; |
| Length | 580 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (1 ESTs); |
| Sequence | ACACAATGCTTCTTGCACCCCCAATATGCTCTTACAACTCCATCTAGAAGTTTGTCTCAG |
| EST members of Unigene | CX524320 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.3148.1.S1_at
|
| Corresponding NCBI Gene | 837178 |
| Trichome-related Gene from Literature | N/A |