Detail of EST/Unigene CX524665 |
Acc. | CX524665 |
Internal Acc. | s13dNF09F12AT103_477964 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Alanine aminotransferase 2-like OS=Danio rerio E-value=7e-24; Alanine aminotransferase 2 OS=Xenopus laevis E-value=5e-22; Alanine aminotransferase 2 OS=Mus musculus E-value=7e-22; Alanine aminotransferase 1 OS=Homo sapiens E-value=7e-22; Alanine aminotransferase 2 OS=Xenopus tropicalis E-value=1e-21; |
Length | 538 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (1 ESTs); |
Sequence | GTAATTGCTACTATCTTAACAAATGAATAATTTATTATTATAATCAGTTTTTTGCTTCTA |
EST members of Unigene | CX524665 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
EC | 2.6.1.2 4.4.1.14 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34790.1.S1_at
|
Corresponding NCBI Gene | 838301 |
Trichome-related Gene from Literature | N/A |