| Detail of EST/Unigene CX525100 |
| Acc. | CX525100 |
| Internal Acc. | s13dNF22E03AT023_478834 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 524 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (1 ESTs); |
| Sequence | CATACATACATTATATATAATAAATATAATAATTATCGGTATAAAAATTATAATGGGTAC |
| EST members of Unigene | CX525100 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
| EC | 2.7.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.36787.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |