Detail of EST/Unigene CX525743 |
Acc. | CX525743 |
Internal Acc. | s13dNF30E01AT006_509230 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase U1 OS=Arabidopsis thaliana E-value=3e-38; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=9e-37; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-36; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=3e-36; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=6e-36; |
Length | 594 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (1 ESTs); |
Sequence | TGGGAAGCCAAGATGTGAAGTTGGTAGGCTTTTGGGTGAGTCCATTTGTTAAGAGGGTTG |
EST members of Unigene | CX525743 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
Msa.1774.1.S1_at, Mtr.6811.1.S1_at, Mtr.6811.1.S1_s_at
|
Corresponding NCBI Gene | 817498 |
Trichome-related Gene from Literature | N/A |