Detail of EST/Unigene CX526357 |
Acc. | CX526357 |
Internal Acc. | s13dNF35A03AT021_510458 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Actin, muscle OS=Manduca sexta E-value=1e-13; Actin, cytoskeletal 3B OS=Strongylocentrotus purpuratus E-value=1e-13; Actin, cytoskeletal 3A OS=Strongylocentrotus purpuratus E-value=1e-13; Actin, cytoskeletal 2A OS=Strongylocentrotus purpuratus E-value=1e-13; Actin-2 OS=Caenorhabditis elegans E-value=1e-13; |
Length | 250 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (1 ESTs); |
Sequence | GCAGCTACTACACGGCCGCAGACCCAAGTCGTCCAATTCTTTTCGTCGTAGACCGGTAAC |
EST members of Unigene | CX526357 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34847.1.S1_at
|
Corresponding NCBI Gene | 836056 |
Trichome-related Gene from Literature | 836056 |