| Detail of EST/Unigene CX526357 |
| Acc. | CX526357 |
| Internal Acc. | s13dNF35A03AT021_510458 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin, muscle OS=Manduca sexta E-value=1e-13; Actin, cytoskeletal 3B OS=Strongylocentrotus purpuratus E-value=1e-13; Actin, cytoskeletal 3A OS=Strongylocentrotus purpuratus E-value=1e-13; Actin, cytoskeletal 2A OS=Strongylocentrotus purpuratus E-value=1e-13; Actin-2 OS=Caenorhabditis elegans E-value=1e-13; |
| Length | 250 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (1 ESTs); |
| Sequence | GCAGCTACTACACGGCCGCAGACCCAAGTCGTCCAATTCTTTTCGTCGTAGACCGGTAAC |
| EST members of Unigene | CX526357 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.34847.1.S1_at
|
| Corresponding NCBI Gene | 836056 |
| Trichome-related Gene from Literature | 836056 |