Detail of EST/Unigene CX526507 |
Acc. | CX526507 |
Internal Acc. | s13dNF46F01AT014_510758 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 33 OS=Arabidopsis thaliana E-value=4e-31; Furcatin hydrolase OS=Viburnum furcatum E-value=2e-30; Beta-glucosidase 30 OS=Oryza sativa subsp. japonica E-value=2e-30; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=2e-30; Beta-glucosidase 29 OS=Oryza sativa subsp. japonica E-value=2e-30; |
Length | 495 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (1 ESTs); |
Sequence | TGATAAATTTGATACAAAGATTGAGCATTACACGAGATATAAGAAGGATGTGCAAAAATT |
EST members of Unigene | CX526507 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34852.1.S1_at
|
Corresponding NCBI Gene | 817847 |
Trichome-related Gene from Literature | N/A |