Detail of EST/Unigene CX526621 |
Acc. | CX526621 |
Internal Acc. | s13dNF36H02AT028_513754 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana E-value=1e-43; UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana E-value=5e-43; UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana E-value=9e-43; UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana E-value=3e-42; UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana E-value=4e-42; |
Length | 606 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Shoots (1 ESTs); |
Sequence | TGAAATTTCAGATAGAGGCTTAATTGCAAGTTGGTGTCCACAGGAGAAAGTATTGAACCA |
EST members of Unigene | CX526621 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.6831.1.S1_at
|
Corresponding NCBI Gene | 838841 |
Trichome-related Gene from Literature | N/A |