| Detail of EST/Unigene CX528246 |
| Acc. | CX528246 |
| Internal Acc. | s13dNF53C12AT098_517004 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chaperonin 60 subunit beta 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-38; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=4e-30; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-30; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=9e-30; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-28; |
| Length | 622 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Shoots (1 ESTs); |
| Sequence | CTTATCCACCAAAATTCTCCAAACTCCAAAACATTGCTGTATTTTTCAACTTACTGCTCT |
| EST members of Unigene | CX528246 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.33066.1.S1_s_at
|
| Corresponding NCBI Gene | 839164 |
| Trichome-related Gene from Literature | N/A |