Detail of EST/Unigene CX537908 |
Acc. | CX537908 |
Internal Acc. | s13dNF38C11GS082_459054 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-09; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=4e-08; Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=6e-08; Dihydrodipicolinate synthase 2, chloroplastic OS=Triticum aestivum E-value=2e-07; |
Length | 205 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | GCCTCGTGCCGAATTCGGCACGAGGCAGAGGAGAGAGTTTGTGAATTTGGTGAAGGAAAT |
EST members of Unigene | CX537908 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.35199.1.S1_at
|
Corresponding NCBI Gene | 819152 |
Trichome-related Gene from Literature | N/A |