| Detail of EST/Unigene CX537908 |
| Acc. | CX537908 |
| Internal Acc. | s13dNF38C11GS082_459054 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-09; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-09; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=4e-08; Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=6e-08; Dihydrodipicolinate synthase 2, chloroplastic OS=Triticum aestivum E-value=2e-07; |
| Length | 205 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (1 ESTs); |
| Sequence | GCCTCGTGCCGAATTCGGCACGAGGCAGAGGAGAGAGTTTGTGAATTTGGTGAAGGAAAT |
| EST members of Unigene | CX537908 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.35199.1.S1_at
|
| Corresponding NCBI Gene | 819152 |
| Trichome-related Gene from Literature | N/A |