| Detail of EST/Unigene CX540271 |
| Acc. | CX540271 |
| Internal Acc. | s13dNF68B01GS009_463816 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 16 OS=Arabidopsis thaliana E-value=4e-37; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=3e-29; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=3e-08; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=1e-05; |
| Length | 644 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (1 ESTs); |
| Sequence | GTGCAGTAGTAACCTCTTTCGATGCAGATCAGAAAATGGCACCGAAACCAACAAAACGGC |
| EST members of Unigene | CX540271 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10118.1.S1_at
|
| Corresponding NCBI Gene | 819820 |
| Trichome-related Gene from Literature | N/A |