Detail of EST/Unigene CX540271 |
Acc. | CX540271 |
Internal Acc. | s13dNF68B01GS009_463816 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 16 OS=Arabidopsis thaliana E-value=4e-37; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=3e-29; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=3e-08; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=1e-05; |
Length | 644 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | GTGCAGTAGTAACCTCTTTCGATGCAGATCAGAAAATGGCACCGAAACCAACAAAACGGC |
EST members of Unigene | CX540271 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10118.1.S1_at
|
Corresponding NCBI Gene | 819820 |
Trichome-related Gene from Literature | N/A |