Detail of EST/Unigene CX540318 |
Acc. | CX540318 |
Internal Acc. | s13dNF68F07GS062_463910 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=4e-94; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-88; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=2e-51; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=3e-48; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=6e-48; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | GCAGATTTGCTCTCATTCTCTCAATTCCAATCTAACGCCGACGCTTGGATCAAAAACAGT |
EST members of Unigene | CX540318 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.7098.1.S1_at
|
Corresponding NCBI Gene | 835760 |
Trichome-related Gene from Literature | N/A |