Detail of EST/Unigene CX540469 |
Acc. | CX540469 |
Internal Acc. | s13dNF49F07GS059_464214 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | WEB family protein At5g16730, chloroplastic OS=Arabidopsis thaliana E-value=1e-34; WEB family protein At3g02930, chloroplastic OS=Arabidopsis thaliana E-value=4e-34; Putative WEB family protein At1g65010, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; WEB family protein At4g27595, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; |
Length | 567 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | GGGAAGTTGAGACCGAGGCAATCCATCTGCAGGAAGCTCTAAAGGAAGTAACGTCTGAGA |
EST members of Unigene | CX540469 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.11541.1.S1_at
|
Corresponding NCBI Gene | 831536 |
Trichome-related Gene from Literature | N/A |