| Detail of EST/Unigene CX540469 |
| Acc. | CX540469 |
| Internal Acc. | s13dNF49F07GS059_464214 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | WEB family protein At5g16730, chloroplastic OS=Arabidopsis thaliana E-value=1e-34; WEB family protein At3g02930, chloroplastic OS=Arabidopsis thaliana E-value=4e-34; Putative WEB family protein At1g65010, chloroplastic OS=Arabidopsis thaliana E-value=4e-12; WEB family protein At4g27595, chloroplastic OS=Arabidopsis thaliana E-value=7e-09; |
| Length | 567 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (1 ESTs); |
| Sequence | GGGAAGTTGAGACCGAGGCAATCCATCTGCAGGAAGCTCTAAAGGAAGTAACGTCTGAGA |
| EST members of Unigene | CX540469 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.11541.1.S1_at
|
| Corresponding NCBI Gene | 831536 |
| Trichome-related Gene from Literature | N/A |