Detail of EST/Unigene CX540565 |
Acc. | CX540565 |
Internal Acc. | s13dNF0CA11GS085_464406 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 5'-nucleotidase domain-containing protein DDB_G0275467 OS=Dictyostelium discoideum E-value=1e-32; 5'-nucleotidase domain-containing protein 3 OS=Xenopus laevis E-value=1e-26; 5'-nucleotidase domain-containing protein 3 OS=Homo sapiens E-value=1e-25; 5'-nucleotidase domain-containing protein 3 OS=Mus musculus E-value=2e-25; 5'-nucleotidase domain-containing protein 2 OS=Rattus norvegicus E-value=2e-23; |
Length | 625 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | GCTTCTCCCTTCATCTTCTGCACTTCAACAAGGGATTTCTGGAAGCTCTCGAAGCTATGG |
EST members of Unigene | CX540565 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01081 5'-nucleotidase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01081 5'-nucleotidase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K01081 5'-nucleotidase |
EC | 3.1.3.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.7104.1.S1_at
|
Corresponding NCBI Gene | 816921 |
Trichome-related Gene from Literature | N/A |