Detail of EST/Unigene CX541536 |
Acc. | CX541536 |
Internal Acc. | s13dNF87B01GS013_466374 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Plastidial pyruvate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-62; Pyruvate kinase isozyme A, chloroplastic OS=Ricinus communis E-value=2e-62; Pyruvate kinase isozyme A, chloroplastic OS=Nicotiana tabacum E-value=7e-62; Plastidial pyruvate kinase 2 OS=Arabidopsis thaliana E-value=2e-26; Plastidial pyruvate kinase 3, chloroplastic OS=Arabidopsis thaliana E-value=4e-24; |
Length | 555 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (1 ESTs); |
Sequence | GTACTGTTGGTCCTGCTTGTAGTTCATTGGAGGATCTAGAGAAGTTGGCATTGGGAGGAA |
EST members of Unigene | CX541536 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
EC | 2.7.1.40 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13705.1.S1_at
|
Corresponding NCBI Gene | 821870 |
Trichome-related Gene from Literature | N/A |