Detail of EST/Unigene DN171243 |
Acc. | DN171243 |
Internal Acc. | LH__Ea08J09.f |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, acidic isoform PR-Q' OS=Nicotiana tabacum E-value=7e-53; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Prunus persica E-value=5e-38; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=9e-38; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=2e-36; Glucan endo-1,3-beta-glucosidase, acidic isoform OS=Arabidopsis thaliana E-value=2e-35; |
Length | 451 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LH__Ea (1 ESTs); |
Sequence | AAATGTAACCCTCAATAGGCTTGGAGGGCCTTTTAGGACTCCCTCTTTTCACTTGTCTAG |
EST members of Unigene | DN171243 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |