| Detail of EST/Unigene DN172256 |
| Acc. | DN172256 |
| Internal Acc. | LH__Ea10E15.f |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=7e-90; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=7e-90; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=2e-87; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=8e-86; |
| Length | 793 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | LH__Ea (1 ESTs); |
| Sequence | ATATAACTTTTATATATTCATATCAAGGCCATTAAGGAGGCCGTACATTTGTCAACACAT |
| EST members of Unigene | DN172256 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824893 |
| Trichome-related Gene from Literature | 824893 |