Detail of EST/Unigene DN172256 |
Acc. | DN172256 |
Internal Acc. | LH__Ea10E15.f |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase A OS=Solanum lycopersicum E-value=0; Glucan endo-1,3-beta-glucosidase, acidic isoform PR-N (Fragment) OS=Nicotiana tabacum E-value=7e-90; Glucan endo-1,3-beta-glucosidase, acidic isoform GI9 OS=Nicotiana tabacum E-value=7e-90; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=2e-87; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=8e-86; |
Length | 793 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | LH__Ea (1 ESTs); |
Sequence | ATATAACTTTTATATATTCATATCAAGGCCATTAAGGAGGCCGTACATTTGTCAACACAT |
EST members of Unigene | DN172256 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824893 |
Trichome-related Gene from Literature | 824893 |