Detail of EST/Unigene DY617642 |
Acc. | DY617642 |
Internal Acc. | AC3778 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=7e-94; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=2e-74; |
Length | 842 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_NOLLY (1 ESTs); |
Sequence | GGGAGCTGGTGGCCGAACCTCTGTTCCTCCTTCGGCTAGGAAGTCAGAGAATGACACTGT |
EST members of Unigene | DY617642 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2782.1.S1_at
|
Corresponding NCBI Gene | 820387 |
Trichome-related Gene from Literature | 820387 |