| Detail of EST/Unigene ES611317 |
| Acc. | ES611317 |
| Internal Acc. | MTGland_A006_2007-04-03/MTGlandA006_C01_006_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-54; Lichenase OS=Nicotiana plumbaginifolia E-value=1e-53; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=8e-53; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=5e-52; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=4e-51; |
| Length | 731 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI (1 ESTs); |
| Sequence | AGTTTATACTTTGATATAATTCAAGCAATACACTCTTGAAAAGAAACTCTTCGATCATGT |
| EST members of Unigene | ES611317 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.49787.1.S1_s_at
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |