Detail of EST/Unigene ES611317 |
Acc. | ES611317 |
Internal Acc. | MTGland_A006_2007-04-03/MTGlandA006_C01_006_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Vitis vinifera E-value=2e-54; Lichenase OS=Nicotiana plumbaginifolia E-value=1e-53; Glucan endo-1,3-beta-glucosidase OS=Nicotiana tabacum E-value=8e-53; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=5e-52; Glucan endo-1,3-beta-glucosidase, acidic isoform GL153 OS=Nicotiana tabacum E-value=4e-51; |
Length | 731 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_TRI (1 ESTs); |
Sequence | AGTTTATACTTTGATATAATTCAAGCAATACACTCTTGAAAAGAAACTCTTCGATCATGT |
EST members of Unigene | ES611317 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.49787.1.S1_s_at
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |