Detail of EST/Unigene EX516836 |
Acc. | EX516836 |
Internal Acc. | Hops-Column34R_2007-07-13/HopsColumn-34R_D06_021_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-42; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=2e-38; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=1e-37; Gamma-glutamyltranspeptidase 1 OS=Sus scrofa E-value=1e-37; Gamma-glutamyltranspeptidase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-34; |
Length | 922 nt |
Species | Humulus lupulus |
Belonged EST Libraries | HL_TRI (1 ESTs); |
Sequence | AAGAAACTTCTGCTAGAGCTTAATGATGGTAACGTCTTATACATCTTTTTGGCATAGTTT |
EST members of Unigene | EX516836 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830119 |
Trichome-related Gene from Literature | 830119 |