Detail of EST/Unigene EX521954 |
Acc. | EX521954 |
Internal Acc. | ALF(R)-19_2007-08-09_1/ALF(R)-19_K23_043_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 reductase 4 OS=Mus musculus E-value=4e-26; Cytochrome b5 reductase 4 OS=Homo sapiens E-value=4e-26; Cytochrome b5 reductase 4 OS=Bos taurus E-value=4e-26; Cytochrome b5 reductase 4 OS=Rattus norvegicus E-value=2e-25; Cytochrome b5 reductase 4 OS=Xenopus tropicalis E-value=6e-25; |
Length | 829 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2 (1 ESTs); |
Sequence | AAATTCACACGACAGAGACCTTCAGTTGGCACGAAACAGCAGAGAGTAACAAAATCGCAA |
EST members of Unigene | EX521954 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- 1.6.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42015.1.S1_at
|
Corresponding NCBI Gene | 830827 |
Trichome-related Gene from Literature | N/A |