| Detail of EST/Unigene EX524302 |
| Acc. | EX524302 |
| Internal Acc. | ALF-R-15_2007-07-25_1/ALF(R)-15_F03_006_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Estradiol 17-beta-dehydrogenase 12 OS=Rattus norvegicus E-value=5e-40; Estradiol 17-beta-dehydrogenase 12 OS=Macaca fascicularis E-value=4e-39; Estradiol 17-beta-dehydrogenase 12 OS=Mus musculus E-value=7e-39; Estradiol 17-beta-dehydrogenase 12 OS=Homo sapiens E-value=5e-38; Estradiol 17-beta-dehydrogenase 12 OS=Bos taurus E-value=8e-38; |
| Length | 774 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI2 (1 ESTs); |
| Sequence | TCTGGTTCCTCATTCTCTTCTCCCTCGGTCTCTTCACCATTCTCAGATCCACTCTTCTTC |
| EST members of Unigene | EX524302 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
| EC | 1.1.1.- 1.1.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843098 |
| Trichome-related Gene from Literature | N/A |