Detail of EST/Unigene EX524720 |
Acc. | EX524720 |
Internal Acc. | ALF-R-17_2007-07-25_1/ALF(R)-17_C21_047_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=1e-29; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=3e-15; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=8e-15; Carboxymethylenebutenolidase homolog OS=Homo sapiens E-value=1e-14; Carboxymethylenebutenolidase homolog OS=Xenopus laevis E-value=2e-14; |
Length | 714 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2 (1 ESTs); |
Sequence | GTTGCTAAACCTGGTGGTGTTGATGCTTATCCCACTGGTTCTCCTCTTTGCACCTTCGCC |
EST members of Unigene | EX524720 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.-.- 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821939 |
Trichome-related Gene from Literature | N/A |