| Detail of EST/Unigene EX524720 | 
| Acc. | EX524720 | 
| Internal Acc. | ALF-R-17_2007-07-25_1/ALF(R)-17_C21_047_1 | 
| Type | Singleton/Unigene | 
| Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=1e-29; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=3e-15; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=8e-15; Carboxymethylenebutenolidase homolog OS=Homo sapiens E-value=1e-14; Carboxymethylenebutenolidase homolog OS=Xenopus laevis E-value=2e-14; | 
| Length | 714 nt | 
| Species | Medicago sativa | 
| Belonged EST Libraries | MS_TRI2 (1 ESTs); | 
| Sequence | GTTGCTAAACCTGGTGGTGTTGATGCTTATCCCACTGGTTCTCCTCTTTGCACCTTCGCC | 
| EST members of Unigene | EX524720 | 
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase | 
| EC | 3.1.-.- 3.1.1.45 | 
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset | 
 
  | 
| Corresponding NCBI Gene | 821939 | 
| Trichome-related Gene from Literature | N/A |