Detail of EST/Unigene EX524974 |
Acc. | EX524974 |
Internal Acc. | ALF-R-18_2007-07-25_1/ALF(R)-18_F11_022_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized oxidoreductase ykwC OS=Bacillus subtilis (strain 168) E-value=5e-31; 2-hydroxy-3-oxopropionate reductase OS=Escherichia coli (strain K12) E-value=2e-19; Uncharacterized oxidoreductase Sfri_1503 OS=Shewanella frigidimarina (strain NCIMB 400) E-value=5e-15; Uncharacterized oxidoreductase slr0229 OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=8e-14; 2-hydroxy-3-oxopropionate reductase OS=Escherichia coli (strain K12) E-value=2e-13; |
Length | 764 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2 (1 ESTs); |
Sequence | TAGGTCGCGCGCTTTAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGT |
EST members of Unigene | EX524974 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K00020 3-hydroxyisobutyrate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00033 6-phosphogluconate dehydrogenase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00033 6-phosphogluconate dehydrogenase |
EC | 1.1.1.31 1.1.1.44 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829033 |
Trichome-related Gene from Literature | N/A |