| Detail of EST/Unigene EX525256 |
| Acc. | EX525256 |
| Internal Acc. | ALF-R-3_2007-07-16_1/ALF(R)-3_J10_020_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=0; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=5e-94; Probable acyl-activating enzyme 12, peroxisomal OS=Arabidopsis thaliana E-value=3e-82; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=8e-81; Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=1e-80; |
| Length | 945 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI2 (1 ESTs); |
| Sequence | GGACCACTGCTAGTCCAAAAGGTGTGGTTTTGCATCACCGTGGAGCATATCTCATGTCTC |
| EST members of Unigene | EX525256 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
| EC | 6.2.1.12 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820946 |
| Trichome-related Gene from Literature | N/A |