| Detail of EST/Unigene EX525492 |
| Acc. | EX525492 |
| Internal Acc. | ALF-R-4_2007-07-17_1/ALF(R)-4_L03_003_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized protein ORF91 OS=Phalaenopsis aphrodite subsp. formosana E-value=7e-42; Serine/threonine-protein kinase HT1 OS=Arabidopsis thaliana E-value=7e-32; Probable serine/threonine-protein kinase DDB_G0267514 OS=Dictyostelium discoideum E-value=2e-21; Probable serine/threonine-protein kinase DDB_G0272254 OS=Dictyostelium discoideum E-value=4e-21; Raf homolog serine/threonine-protein kinase OS=Caenorhabditis briggsae E-value=3e-20; |
| Length | 979 nt |
| Species | Medicago sativa |
| Belonged EST Libraries | MS_TRI2 (1 ESTs); |
| Sequence | GGGGGNCGCAGTGACCAGGCCCGGGCGACTGTTTACCAAAAACACAGGTCTCCGCAAAGT |
| EST members of Unigene | EX525492 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04365 B-Raf proto-oncogene serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04427 mitogen-activated protein kinase kinase kinase 7; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04427 mitogen-activated protein kinase kinase kinase 7 |
| EC | 2.7.11.1 2.7.11.25 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
Mtr.33693.1.S1_at
|
| Corresponding NCBI Gene | 822378 |
| Trichome-related Gene from Literature | N/A |