Detail of EST/Unigene EX525825 |
Acc. | EX525825 |
Internal Acc. | ALF-R-6_2007-07-18_1/ALF(R)-6_E23_046_1 |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glyoxylate reductase OS=Thermococcus onnurineus (strain NA1) E-value=1e-25; Glyoxylate reductase OS=Pyrococcus abyssi (strain GE5 / Orsay) E-value=1e-25; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=6e-25; Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=1e-24; Glyoxylate reductase OS=Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3) E-value=4e-23; |
Length | 988 nt |
Species | Medicago sativa |
Belonged EST Libraries | MS_TRI2 (1 ESTs); |
Sequence | GATGAAACAAAGAATCTCCCAAAAGTATTTTTTCACGGTCCACCCNAACTCCCCGGATAT |
EST members of Unigene | EX525825 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+); Environmental Information Processing > Signal Transduction > ko04330 Notch signaling pathway > K04496 C-terminal binding protein; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04496 C-terminal binding protein |
EC | 1.1.1.79 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819171 |
Trichome-related Gene from Literature | N/A |