| Detail of EST/Unigene EX529916 |
| Acc. | EX529916 |
| Internal Acc. | MTGland_A060_2007-06-22/MTGlandA060_E06_020_1 |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 12 OS=Arabidopsis thaliana E-value=2e-13; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=2e-13; SKP1-like protein 1B OS=Arabidopsis thaliana E-value=2e-13; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=2e-13; S-phase kinase-associated protein 1 OS=Xenopus laevis E-value=3e-13; |
| Length | 855 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_TRI (1 ESTs); |
| Sequence | GAGGTTAATGTGGTTATGCTATTCGAACTCATCCGGGCCGCAAACTATTTAAACGTCAAG |
| EST members of Unigene | EX529916 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.373.1.S1_at
|
| Corresponding NCBI Gene | 829598 |
| Trichome-related Gene from Literature | 829598 |