Detail of EST/Unigene EY041915 |
Acc. | EY041915 |
Internal Acc. | CAIY596.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase OS=Caenorhabditis briggsae E-value=5e-12; Serine hydroxymethyltransferase, cytosolic OS=Ovis aries E-value=1e-11; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=2e-11; Serine hydroxymethyltransferase, cytosolic OS=Oryctolagus cuniculus E-value=2e-11; Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=4e-11; |
Length | 303 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY (1 ESTs); |
Sequence | TGCGCAGGTTCCGGGCGGTATTCGTCTCGGCACGTCTGCGCTCACGTCGCGTAACATGCT |
EST members of Unigene | EY041915 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829949 |
Trichome-related Gene from Literature | 829949 |