| Detail of EST/Unigene EY043474 |
| Acc. | EY043474 |
| Internal Acc. | CAIY6745.fwd |
| Type | Singleton/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized zinc-type alcohol dehydrogenase-like protein YbdR OS=Escherichia coli (strain K12) E-value=3e-24; Uncharacterized zinc-type alcohol dehydrogenase-like protein AdhB OS=Bacillus subtilis (strain 168) E-value=9e-24; S-(hydroxymethyl)glutathione dehydrogenase OS=Methylobacter marinus E-value=1e-23; Zinc-type alcohol dehydrogenase-like protein C1198.01 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-22; Alcohol dehydrogenase OS=Cupriavidus necator E-value=4e-21; |
| Length | 703 nt |
| Species | Artemisia annua |
| Belonged EST Libraries | AA_CAIY (1 ESTs); |
| Sequence | ACTGGAGCCATCAGGGGTTTGACCATGTCGCCAGGCGCAGACCAGAATGGCTTCGCCTAT |
| EST members of Unigene | EY043474 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
| EC | 1.1.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829955 |
| Trichome-related Gene from Literature | 829955 |