Detail of EST/Unigene EY045141 |
Acc. | EY045141 |
Internal Acc. | CAIY7610.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=9e-29; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=1e-24; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-23; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=2e-22; 30S ribosomal protein S17 OS=Rhodobacter sphaeroides (strain KD131 / KCTC 12085) E-value=5e-11; |
Length | 528 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY (1 ESTs); |
Sequence | AAAACACAATGTCTCTCCTCACCAATTTCAAATCCCTCACACTCTCCACCCCCTTCCTCC |
EST members of Unigene | EY045141 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844324 |
Trichome-related Gene from Literature | 844324 |