Detail of EST/Unigene EY046505 |
Acc. | EY046505 |
Internal Acc. | CAIY8303.fwd |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3B, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=3e-06; Chlorophyll a-b binding protein 3A, chloroplastic (Fragments) OS=Solanum lycopersicum E-value=4e-06; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=7e-06; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=7e-06; |
Length | 630 nt |
Species | Artemisia annua |
Belonged EST Libraries | AA_CAIY (1 ESTs); |
Sequence | CTTCAACTACCATTTTTCTCATTAGTCTTACCATCTACTTTGAAAATACATCAATGGCTG |
EST members of Unigene | EY046505 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |