Detail of EST/Unigene EY477143 |
Acc. | EY477143 |
Internal Acc. | METAZ77TF |
Type | Singleton/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase T2 OS=Arabidopsis thaliana E-value=9e-58; Glutathione S-transferase T1 OS=Arabidopsis thaliana E-value=1e-57; Glutathione S-transferase T3 OS=Arabidopsis thaliana E-value=3e-56; Glutathione S-transferase theta-2 OS=Rattus norvegicus E-value=2e-20; Glutathione S-transferase theta-2 OS=Mus musculus E-value=5e-20; |
Length | 798 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT3 (1 ESTs); |
Sequence | AAGGTGTATGCAGATCGAATGTCCCAACCATCTCGAGCAGTTCTTATATTCTGCAGGTTC |
EST members of Unigene | EY477143 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.26627.1.S1_at
|
Corresponding NCBI Gene | 834125 |
Trichome-related Gene from Literature | N/A |